Abhi Tripathi ☁
Seattle, Washington, United States
10K followers
500+ connections
10K followers
500+ connections
About
☁ A Passionate Salesforce Developer, PRO on Salesforce community, been working on for…
Articles by Abhi
Activity
-
🎉 We are proud to partner with Amazon on the launch of Amazon Bio Discovery, a platform that connects AI-driven design directly to wet lab…
🎉 We are proud to partner with Amazon on the launch of Amazon Bio Discovery, a platform that connects AI-driven design directly to wet lab…
Liked by Abhi Tripathi ☁
-
Moving from traditional support to autonomous contact center agents is no longer a tech upgrade—it’s a strategic shift from cost center to revenue…
Moving from traditional support to autonomous contact center agents is no longer a tech upgrade—it’s a strategic shift from cost center to revenue…
Liked by Abhi Tripathi ☁
-
Late Post ! It has only been about 7 months with this organization, and I already feel like I have learned so much. The journey so far has been…
Late Post ! It has only been about 7 months with this organization, and I already feel like I have learned so much. The journey so far has been…
Liked by Abhi Tripathi ☁
Experience
Education
Licenses & Certifications
Languages
-
English
-
-
Hindi
-
Recommendations received
2 people have recommended Abhi
Join now to viewMore activity by Abhi
-
AATGAGGTCGAGAGAGGTCAGAATAATGCGGGTATTGTCGAGTACCAGGTAGTACCCTGAAATGAGGTCGAGAGAGGTCAGAATAATGCGCTGGAGACTTACCAGGTAGATCAGTGGAATTGAAATGAGGTCGAGAGAGGTCAGAATAAT…
AATGAGGTCGAGAGAGGTCAGAATAATGCGGGTATTGTCGAGTACCAGGTAGTACCCTGAAATGAGGTCGAGAGAGGTCAGAATAATGCGCTGGAGACTTACCAGGTAGATCAGTGGAATTGAAATGAGGTCGAGAGAGGTCAGAATAAT…
Liked by Abhi Tripathi ☁
-
A lot of GenAI discussion focuses on prompts and chunking. But for complex enterprise use cases, the bigger advantage often comes from how the data…
A lot of GenAI discussion focuses on prompts and chunking. But for complex enterprise use cases, the bigger advantage often comes from how the data…
Liked by Abhi Tripathi ☁
-
I’m happy to share that I’ve obtained a new certification: Copado Certified Fundamentals II from Copado! 🎉 #Copado #Certified #Salesforce #DevOps
I’m happy to share that I’ve obtained a new certification: Copado Certified Fundamentals II from Copado! 🎉 #Copado #Certified #Salesforce #DevOps
Liked by Abhi Tripathi ☁
-
Celebrating all the amazing women who have shaped who we are and who we will become.
Celebrating all the amazing women who have shaped who we are and who we will become.
Liked by Abhi Tripathi ☁
-
“While there are thousands of publicly traded companies worldwide, we have only found 44 thus far that had women involved from the very…
“While there are thousands of publicly traded companies worldwide, we have only found 44 thus far that had women involved from the very…
Liked by Abhi Tripathi ☁
-
What Does 2026 Hold For Biopharma? Our president and COO, Patrick Finn shares his thoughts! He highlights: •The competitive edge will come from…
What Does 2026 Hold For Biopharma? Our president and COO, Patrick Finn shares his thoughts! He highlights: •The competitive edge will come from…
Liked by Abhi Tripathi ☁
-
Twist Bioscience reported FQ1 revenues of $103.7M, exceeding expectations and signaling a positive trajectory for its NGS and DNA Synthesis segments.…
Twist Bioscience reported FQ1 revenues of $103.7M, exceeding expectations and signaling a positive trajectory for its NGS and DNA Synthesis segments.…
Liked by Abhi Tripathi ☁
-
1st February marked more than the inauguration of a new office in Jaipur. It marked Briskminds entering its new home, and doing it with the people…
1st February marked more than the inauguration of a new office in Jaipur. It marked Briskminds entering its new home, and doing it with the people…
Liked by Abhi Tripathi ☁
-
#Hiring_Alert #Role 1:- Role Name Salesforce Core Developer w/ Experience Cloud and Shield Start Date Immediate End Date 2/20/2026 Location:…
#Hiring_Alert #Role 1:- Role Name Salesforce Core Developer w/ Experience Cloud and Shield Start Date Immediate End Date 2/20/2026 Location:…
Liked by Abhi Tripathi ☁
Other similar profiles
Explore top content on LinkedIn
Find curated posts and insights for relevant topics all in one place.
View top content